and maceration, require a lot of solvent, time, andenergy, but are popular and effective. However, newextraction technologies are being actively introduced, e.g.ultrasonic, microwave, infrared, and fluid supercriticalextractions. They are energy saving and environmentallyfriendly, according to one of the latest books on theextraction of biological active substances from plant andanimal raw materials [23]. Still, an optimal extractiontechnology should be simple, safe, reproducible,inexpensive, and suitable for industrial use [24].Ultrasonic (US) extraction is a fairly cheap methodthat requires minimal hardware design [25]. It destroyscell walls (lysis) and disintegrates individual cellularstructures and the cell as a whole, which increasesthe number of components that enter the extract. USproduces a mechanical effect: the solvent penetratesinto the matrix of berries, thus increasing the area of thecontact surface between the solid and the liquid phases[26]. Moreover, US waves can cause some undesirablechemical processes that can change the chemicalcomposition, degrade the target compounds, and causefree radicals in gas bubbles [27]. Therefore, a set ofexperiments is required to define the optimal extractionconditions, i.e. time, temperature, power, and ultrasonicfrequency.Microwave (MW) radiation is another possible wayto increase extraction efficiency [28]. MW radiation isa popular means of extraction, as far as low-molecularcompounds from plant raw material are concerned.The research objective was to obtain a semi-finishedraspberry product using MW and US processing, as wellas to study its antioxidant, anti-carcinogenic, sensory,physico-chemical, and microbiological properties.STUDY OBJECTS AND METHODSThe experiments were performed on the premisesof the Department of Technology and Catering at theSamara State Technical University (Samara, Russia).The anti-inflammatory and cytostatic, or cytotoxic,properties were determined in the N.N. Blokhin NationalMedical Research Oncology Center (Moscow, Russia).The research featured a variety of fresh raspberries(Rúbus idáeus L.) harvested in the Samara region(53°12′N - 50°06′E) in 2017. The raspberries wereprovided by the Research Institute of Horticulture andMedicinal Plants ‘Zhigulyovskie Sady’ (Samara, Russia).Determination of the antioxidant propertiesindicators.Chemicals and reagents. The experimentused ethanol and distilled water. The Folin-Ciocalteu reagent (FCR) and the gallic acid wereprovided by the Fluka company (Germany). TheDPPH (2,2-diphenyl-1-picrylhydrazyl), sodium nitrite,48Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Хaluminum chloride, sodium carbonate, and linoleic acidwere ordered from Sigma-Aldrich, Inc. The 2,4,6-tri(2-pyridyl)-s-triazine (TPTZ) was purchased fromFluka Chemicals (Spain). Other chemicals includedhydrochloric acid, potassium chloride, acetic acid,sodium acetate, sodium phosphate, ferric chloride (II),ferric chloride (III), and ammonium rodanide.Phenolic compounds. The content of total phenolswas estimated using a modified version of the FCRmethod [29]. Gallic acid was used as a standard: anaqueous solution of gallic acid (200 mg in 1000 cm3) wasdiluted with distilled water to obtain the concentrationsappropriate for the calibration curve. The experimentinvolved 0.50 cm3 of the analysed substance or standardgallic acid, 4.00 cm3 of distilled water, 0.25 cm3 of FCRreagent, and 0.25 cm3 of a saturated aqueous solutionof sodium carbonate. The samples were shaken andkept in the dark at room temperature for 30 min. Theabsorption coefficient was determined at 725 nm witha spectrophotometer. Results were expressed in mgequivalent of gallic acid per 100g of dry weight. Theexperiment was performed in triplicate.Flavonoids. The content of flavanoids wasdetermined using a modified method describedDemidova et al [30]. 0.50 cm3 of the analysed substanceor standard catechin solution was put in a 10 cm3measuring tube. After that, 2.50 cm3 of distilled waterwas added at the time zero followed by 0.15 cm3 of a5% aqueous solution of sodium nitrate. After 5 minutes,0.30 cm3 of a 10% aqueous solution of aluminumchloride was added and kept for another 5 min. Theabsorption coefficient was measured at 510 nm. Thecontent of flavonoids was expressed in mg equivalentof catechin per 100g of dry weight. The experiment wasperformed in triplicate.Anthocyanins. To define the total content ofanthocyanins, the absorption coefficient was measuredat two different pH values (1.0 and 4.5) at 515 and 700nm [31]. The content of anthocyanins was expressed inmg equivalent of cyanidin-3-glycoside per 100 g of drymatter. The experiment was performed in triplicate.Antioxidant activity in the linoleic acid system.The antioxidant activity in the linoleic acid systemwas determined according to the method describedKarabegovic [32]. 0.5 cm3 of ethanol, 0.5 cm3 of distilledwater, 1 cm3 o f l inoleic a cid, a nd 2 c m3 of phosphatebuffer (pH 7.0) were added to 1.0 cm3 of the analysedsubstance. The mixture was kept at 40°C for 120 h.Then an aliquot part (0.1 cm3) was isolated from themixture. After that, 9.7 cm3 of 75% ethanol and 0.1 cm3of a 30% ammonium rhodanide solution were added tothe aliquot and allowed to stand for 4 min. Subsequently,0.1 cm3 of ferric chloride (II) solution was added to themixture (0.2 M in 3.5% of HCl). A spectrophotometerwas used to measure the optical density of the mixtureat 500 nm. The control sample contained all the reagentsbut the extract. The antioxidant activity was expressedin percent of inhibition of linoleic acid oxidation. Theexperiment was performed in triplicate.Antioxidant activity by DPPH. The antioxidantproperties of the samples were measured using themethod described Cheigh et al [33]. The method is basedon the ability of the antioxidants of the raw material tobind the stable chromogen radical of 2,2-diphenyl-1-picrylhydrazyl (DPPH). 4 mg of DPPH was dissolvedin 100 cm3 of ethanol. The aliquots were dissolved in100 cm3 of distilled water in the quantities of 0.05, 0.10,0.40, 0.80, 1.00, and 5.00 cm3. Then, 0.2 cm3 of eachsolution was added to 2.0 cm3 of the DPPH solution at20°C and kept in the dark for 30 min. The transmittancewas determined at 517 nm. The antiradical activity wasexpressed as the concentration of the original object inmg/cm3, at which 50% of the radicals were bound. Theexperiment was performed in triplicate.FRAP method. The restoring force of the analysedsubstance was determined by the FRAP method [34].A freshly prepared FRAP solution included 10 cm3of acetate buffer (pH 3.6), 1 cm3 of a 10% solutionof ferric chloride (III) and 1 cm3 of TPTZ solution(2,4,6-tripyridyl-s-triazine) (10 mmol/l TPTZ in 40mmol/1000 cm3 of HCl). The solution was kept at 37°Cfor 10 min. After that, 3.0 cm3 of distilled water and1 cm3 of FRAP solution were added to the analysedsubstance (0.1 cm3). The mixture was allowed to standat 37°C for 4 min. The optical density was measured at593 nm. The restoring force was determined accordingto the calibration graph and expressed in mmol of Fe2 +/1kg of the raw material. The experiment was performedin triplicate.The sensory properties of the raspberry extract weredefined according to State Standard 8756.1-2017*.The microbiological studies of the semi-finishedproduct were performed according to State Standards31659-2012** a nd S tate S tandard 3 0712-2001*** inlicenced testing laboratory No. ROSS RU.0001.510137.The physical and chemical properties weredetermined according to State Standards 34128-2017**** a nd S tate S tandards 3 4127-2017*****.The content of ethanol in the raspberry extract was* State Standard 8756.1-2017. Fruit, vegetable and mushroomproducts. Methods for determination of organolepticcharacteristics, components fraction of total mass and netmass or volume. Mocsow: Standartinform; 2017. 12 p.** State Standards 31659-2012. Food products. Method forthe detection of Salmonella spp. Mocsow: Standartinform;2014. 21 p.*** State Standard 30712-2001. Products of non-alcoholicindustry. Methods of microbiological analysis. Mocsow:Standartinform; 2010. 11 p.**** State Standards 34128-2017. Juice products. Refractometricmethod for the determination of soluble solids massconcentration. Mocsow: Standartinform; 2017. 8 p.***** State Standards 34127-2017. Juice products. Determinationof titratable acidity by method of potentiometrictitration. Mocsow: Standartinform; 2017. 8 p.49Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Хdetermined according to State Standard ISO 2448-2013******. The experiments were performed intriplicate.Statistical data processing. The statisticalprocessing of the results was performed with the helpof Student’s t-test to determine M ± m, where M is themean value, m is the standard error of the mean (thestandard deviation √n) was defined using the MicrosoftExcel software.Determination of potential anticarcinogenicproperties indicators.Anti-inflammatory drugs are known to produce aninhibitory effect on the pro-inflammatory pathways ofcells, including COX2, iNOS, and IL-8. It is currentlyconsidered a proven fact that these drugs exert ananticarcinogenic effect in vivo. That is why the presentstudy featured these very genes and the effect ofraspberry extract on them to determine the potentialanticanceragenic activity of the product.The study used HCT-116 colon cancer cell line [35].The cells were cultured at 37°C in standard DMEMmedium containing 5% fetal calf serum (PAA,Australia) and gentamicin (50 U/cm3) (PanEko, Russia)and in 5% of CO2.Cell viability study (MTT-test). The cells weredispersed into 96-well plates (BDMicro-FinePlus, USA).There were 3×103 cells in 190 μl of culture medium.After that, the cells were incubated for 24 h. Serialdilutions of raspberries were prepared on the day ofthe experiment. The cells were incubated with theextract for 72 h at concentrations of 0.03125–2% (v/v).Then 20μl of the MTT reagent solution were added inthe ratio of 5 mg/cm3 (PanEko, Russia) in Hanks saltsolution (PanEko, Russia). The solution was allowedto uncubate at 37°C for 2 h until it turned violet. Theformazan was then dissolved in 200 μl of dimethylsulfoxide (DMSO, PanEko, Russia) and incubatedat 37°C. After the formazan crystals had completelydissolved, the optical density of the wells was measuredat a wavelength of 570 nm using a MultiScan MCC340 multiwell spectrophotometer (Labsystems, USA).The data were presented as the optical density of theexperimental samples vs. that of the control sample.The optical density in the control sample was taken for100%. The cells in the control sample were incubated ina 1% ethanol solution.RNA isolation. The total cellular RNA was isolatedusing an RNA isolation kit. The RNA concentrationwas determined with a spectrophotometer accordingto the optical density of the solution at a wavelength of260 nm. The absence of impurities in the sample wasstated by the ratio of the optical density of the solution ata wavelength of 260 nm and 280 nm.Reverse transcription reaction. Reversetranscription was used to obtain cDNA. 1μg ofRNA was mixed with 0.4 μg of random hexamer****** State Standard ISO 2448-2013. Fruit and vegetableproducts. Determination of ethanol content. Mocsow:Standartinform; 2014. 11 p.oligonucleotides, denatured at 25°C, and cooled on ice.The reverse transcription mixture included: 2 units ofreverse transcriptase MMLV, a suitable buffer, 2 mMof dithiothreitol, 0.5 units of ribonuclease inhibitor,0.5 mM of dNTP, and ≤ 20 μl of distilled water.The reaction lasted 1 h at 37°C. After that, reversetranscriptase was inactivated at 95°C for 5 min, whichstopped the reaction. After adding 80 μl of distilledwater, the aliquots were used for real-time PCRamplification with specific primers.Quantitative real-time PCR analysis. Afterthe reverse transcription reaction, the samples werediluted 1:10 with sterile deionised water to obtainworking dilutions of cDNA. 5 μl of the cDNA workingsolution was added to 20 μl of the reaction mixture thatcontained SYBR Green Master Mix, 500 nM of thereverse primers and 500 nM of direct primers. A Bio-Rad iQ5 PCR analyser was used to perform a real-timequantitative PCR analysis. The amplification programmewas as follows: 95°C – 10 min, 40 cycles (95°C – 15 s,60°C – 30 s, 72°C – 30 s). The relative change in theexpression of the mRNA was calculated using the ΔΔCtmethod. The ΔΔCt was determined by subtracting theaverage ΔCt of the control sample from the ΔCt of theexperimental samples [36]. For each gene, a PCR analysiswas performed in triplicate, and the melting curves wereobtained for each primer pair to confirm their specificity.To analyse the melting curves, the temperature wasraised from 55°C to 95°C at a pace of 0.5°C. Theribosomal protein gene L27 (Rpl27) was used for control.The primers for cDNA amplification were designedusing the Primer-Bank database and the Oligo 6software [37]. Table 1 shows the primer sequences.Statistical data processing. Statistical processing ofthe results performed with the help of Student’s t-test todetermine M ± m, where M is the mean value, m is thestandard error of the mean (standard deviation √n) wasdefined using the Microsoft Excel software.RESULTS AND DISCUSSIONThe research compares the antioxidant properties ofraspberry extracts obtained by maceration, ultrasonictreatment, and microwave processing. All the extractswere obtained using 50% ethanol, while the raw materialvs. solvent ratio was 1:10 (w/v).Table 1 Primer sequencesGene Sequence (forward/reverse), 5’-3’RPL27 ACC GCT ACC CCC GCA AAG TGCCC GTC GGG CCT TGC GTT TACOX2 CCGGGTACAATCGCACTTATGGCGCTCAGCCATACAGiNOS CGGCCATCACCGTGTTCCCCTGCAGTCGAGTGGTGGTCCAIL-8 TCCTGATTTCTGCAGCTCTGTGTCCAGACAGAGCTCTCTTCCAT50Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–ХThe maceration extract was obtained by storing theraw material and the solvent at 40°C for 120 min.The US extract was obtained using an Elmasonic S15H device at a frequency of 50 kHz at 40°C for 120 min.The MW extract was obtained by using microwaveirradiation with a irradiation rate of 90 W for 1 min.Figure 1 shows the total content of phenols,flavonoids, and anthocyanins.US radiation resulted in the biggest content ofphenolic substances: it increased by 1.50 times ascompared with classical maceration. MW radiationproduced nothing but minor changes: the content of totalphenolic substances in the extract increased by 1.06 times.The US and MW processing also increased theextraction of flavonoids by 1.44 and 1.13 times,respectively.All the methods showed nearly the same content ofanthocyanins in the extracts.Figure 1 Total content of antioxidants in the raspberryextracts: PhS – total content of phenolic substances, mgof gallic acid/100 g of raw material; Fl – total content offlavonoids, mg of catechin/100 g of raw material; Ac – totalcontent of anthocyanins, mg of cyanidin-3-glycoside/100 gof raw material). (1) maceration, (2) US extraction,(3) MW extractionTable 2 Antioxidant properties of the raspberry extractsIndex Maceration USextractionMWextractionRestoring force accordingto the FRAP method,mmol Fe2+/1 kg of rawmaterial7.92 10.08 9.09Antiradical activity bythe DPPH method, EC50,mg/cm310.1 31.5 28.0Antioxidant activity inthe system of linoleicacid,% of inhibition16.6 57.5 54.1Figure 2 Procedure chart for raspberry extract production0150300450600750PhS Fl Acmg/100 g of raw material1 2 30.00.20.40.60.81.0Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Контроль Малина, 0,063 % Малина, 0,031 %0150300450600750PhS Fl Acmg/100 g of raw material1 2 30.60.81.0Raw materialdeliverySelection Washing GrindingUS extraction at 50kHz,40°C, 120 min, 1:10 Filtration Concentrating upto ωPCV 65%Pouring into asepticvessels50% ethanolPulpWater-ethanol mixture Storage and offtake,12 months, 4–7°C, with noexposure to light and airThus, both US and MW methods increased thecontent of biologically active substances in the raspberryextracts. US extraction proved to have the greatestimpact on the content of phenolic substances andflavonoids, while the content of anthocyanins remainedalmost the same in different types of extraction.Table 2 demonstrates the antioxidant properties ofthe raspberry extracts.The inhibitory effect of DPPH free radicals increasedby 1.15 and 1.27 during MW and US extractions,respectively.The restoring force of the US extract increased ascompared with MW and maceration extracts.In addition, US extraction increased the ability of theraspberry extract to inhibit linoleic acid by 3.46 times.Similarly, additional treatment with US or MWradiation increased the antioxidant properties of thesemi-finished products, if compared with classicalmaceration.Thus, US processing is necessary to obtain araspberry extract with a high content of physiologicallyactive substances and high antioxidant properties.The study introduces a optimal conditions forraspberry extract production. The new technologicalscheme is given in Fig. 2.51Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–ХThe experimental data made it possible to define thebest technological modes: ethanol = 50%, US radiationfrequency = 35 kHz, temperature = 40 ± 5°C, time = 120min, raw materials vs. solvent ratio = 1:10. A circulationvacuum evaporator concentrated the extract until thecontent of soluble solids was 65% and the mass fractionof ethanol was ≤ 1.0%.The extract was then analysed by sensory,microbiological, physicochemical, and antioxidantproperties (Table 3).Chronic inflammation is one of the main etiologicalfactors that trigger certain types of cancer. As a result,some anti-inflammatory drugs, e.g. ibuprofen, have ananti-carcinogenic effect on colon cancer.The main objective of this research was to study theanti-inflammatory properties of the raspberry extract.A set of experiments was conducted to study its effecton the expression of the genes of individual componentsof the anti-inflammatory pathway. A colon cancer cellline was studied by the RT-PCR method to measure theeffect of non-toxic extract doses on the expression of thefollowing genes: cyclooxygenase 2 (COX-2), induced NOsynthase (iNOS) and interleukin 8 (IL-8) [38]. The antiinflammatoryeffect of the raspberry extract indicates itspotential anticarcinogenic activity.The functional activity of the COX-2 gene is directlyrelated to inflammation. This gene is expressed bymacrophages, synoviocytes, fibroblasts, smooth vascularmuscles, chondrocytes, and endothelial cells after theyhave been induced with cytokines or growth factors.COX-2-induced prostaglandins – directly or indirectly– enhance the production of the enzyme according tothe positive feedback mechanism [39]. Inhibition ofCOX-2 is considered as one of the main mechanismsof the anti-inflammatory activity of nonsteroidal antiinflammatorydrugs (NSAIDs). Selective inhibition ofthis cyclooxygenase can minimise various side effectsobserved during the inhibition of cyclooxygenase 1.COX-2 plays an important role in the developmentof inflammatory processes and carcinogenesis in thegastrointestinal tract. An increased COX-2 expressionwas observed in 85% of gastrointestinal tumours,which also correlated with low survival. Animal studiesshowed that deleting COX-2 or treating animals withselective COX-2 inhibitors reduced the number, size,and multiplicity of tumours. COX-2 causes tumourprogression as it induces the expression of anti-apoptoticproteins of the Bcl-2 family, which leads to apoptosisresistance in the future [37].IL-8 i s k nown a s a T -cell c hemotactic f actorand a neurophil activating factor (NAF) [40, 41]. Itbelongs to the group of chemokines, which providechemotaxis in the area of inflammation of neutrophils,monocytes, eosinophils, and T-cells. IL-8 possessespronounced pro-inflammatory properties. It causesthe expression of intercellular adhesion molecules andenhances neutrophil adherence to endothelial cellsand subendothelial matrix proteins. Hence, it is animportant mediator of inflammatory response [42].IL-8 is produced b y macrophages, lymphocytes,epithelial cells, fibroblasts, and epidermal cells. IL-8 alsoregulates pro-inflammatory angiogenesis. This cytokineenhances the expression of vascular endothelial growthfactor A (VEGF-A) by endothelial cells and increases theexpression of vascular growth receptor 2 (VEGFR2) [43].iNOS expression is regulated by pro-inflammatorycytokines (tumour necrosis factor-alpha (TNF-α),interleukin-1β (IL-1β), interferon-γ (IFN-γ), hypoxia,oxidative stress, and, according to recent studies, byHsp70 heat shock protein. Inhibition of iNOS resultsfrom the suppression of the pro-inflammatory andproliferative pathways NF-κB and JAK-STAT [44].The expression of these genes can denote thepresence or absence of the anti-inflammatory effectof the extracts on colon cells. This research did notstudy the anticarcinogenic properties of the extractTable 3 Properties of the raspberry extractIndicators Raspberry extractSensorypropertiesAppearance Transparent liquid without residueTaste and aroma Bitter-sweet, like raspberry juiceColour Bright raspberryPhysical andchemicalindicatorsSoluble solids, % 65.0 ± 0.1Titratable acidity,% (expressed as malic acid) 5.50 ± 0.02Mass fraction of ethanol, % < 1.0AntioxidantpropertiesTotal content of phenolic substances, mg of gallic acid/100 g of starting material 654.0 ± 25Total content of flavonoids, mg catechin/100 g of starting material 194.0 ± 13Total content of anthocyanins, mg cyanidin-3-glycoside/100 g of dry matter 50.81 ± 2.14Antiradical activity according to the DPPH method, EC50, mg/cm3 2.02 ± 0.01Restoring force according to the FRAP method, mmol Fe2+/1 kgof starting material22.31 ± 0.04Antioxidant activity in the smooth system of linoleic acid, % of berry inhibition 68.35 ± 0.07MicrobialattributesTotal visible count, CFU/g Not detectedColiforms, CFU/g Not detectedYeast and mould, CFU/g Not detected52Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Хcomponents; however, its results may indicate thefeasibility of in vivo experiments to determine theanticarcinogenic properties of the raspberry extract.We performed an MTT test to define the cytotoxicityof the raspberry extract. A wide range of concentrations(0.03125–2%, v/v) showed that the raspberry extract has acytotoxic effect on colon cancer cells HCT-116 (Table 4).Next, a non-toxic concentration of the raspberryextract was used to define the working concentration.It was used to study the effect of the extract on theexpression level of COX-2, iNOS, and IL-8. Workingconcentrations used were 0.0625 and 0.03125% (v/v).A PCR analysis of COX-2 expression was performedafter colon cancer cells of the HCT-116 line hadundergone a proper treatment. The analysis showedthat the raspberry extract had an inhibitory effect onthe expression of this gene. The effect of the extract onCOX-2 expression depended on the dose. Figure 3 showsthat when the concentration of the extract was 0.063%,COX-2 expression fell down to 43%, i.e. by 2.3 times.When the concentration of the extract was 0.031%, it felldown to 22%, i.e. by 4.5 times.Figure 4 shows some dependencies revealed by theanalysis of iNOS expression. When treating the cellswith the raspberry extract, both concentrations resultedin a decrease in iNOS expression by almost 2 times:47% and 42% for concentrations of 0.063% and 0.031 %,respectively.The PCR analysis showed that the raspberryextract also inhibited IL-8 expression. WhenHCT-116 cells were treated with the raspberry extract atthe concentration of 0.063%, it inhibited IL-8 expressionby 54%, while the concentration of 0.031% inhibitedIL-8 expression by 42%. Fig.5 shows the effect of theraspberry extract on IL-8 expression.CONCLUSIONThe research results made it possible to draw thefollowing conclusions:(1) US or MW treatment improved the extractionprocess and increased the content of biologically activecells and their antioxidant properties. US extraction hada greater impact on the content of phenolic substancesand flavonoids, whereas the content of anthocyaninsremained almost the same after different types ofextraction.(2) The experimental data made it possible to definethe optimal technological parameters: ethanol = 50%,US radiation = 35 kHz, temperature = 40 ± 5°C,time = 120 min, raw materials vs. solvent ratio = 1:10.(3) The study defined the sensory, physical, andchemical quality and safety indicators for raspberryextracts, which did not contradict with the nationalregulatory documentation.(4) The raspberry extract was found able to reducethe expression of pro-inflammatory COX-2, iNOS,and IL-8 genes. This semi-finished product can beTable 4 Effect of raspberry extract on cell viability of thesupercritical HCT-116Cell viability IC50 IC30 IC10Volumeconcentration, %0.25 ± 0.05 0.165 ± 0.01 0.09 ± 0.03Figure 3 Effect of the raspberry extract on COX-2 expression.The quantitative PCR analysis of COX-2 expression wasperformed after HCT-116 cells had been incubated for 24 h atworking concentrations (0.063% and 0.031%). The number ofPCR products was assessed and normalised according to theamount of the PCR product of the Rpl27 gene0150300450600750PhS Fl Acmg/100 g of raw material1 2 30.00.20.40.60.81.0Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Контроль Малина, 0,063 % Малина, 0,031 %Figure 4 Effect of the raspberry extract on iNOS expression.The quantitative PCR analysis of iNOS expression wasperformed after HCT-116 cells had been incubated for 24 hoursat working concentrations (0.063% and 0.031%). The numberof PCR products was assessed and normalized according tothe amount of the PCR product of the Rpl27 gene0150300450600750PhS Fl Acmg/100 g of raw material1 2 30.00.20.40.60.81.0Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Контроль Малина, 0,063 % Малина, 0,031 %Figure 5 Effect of the raspberry extract on IL-8 expression.The quantitative PCR analysis of IL-8 expression wasperformed after HCT-116 cells had been incubated for 24 hoursat working concentrations (0.063% and 0.031%). The numberof PCR products was assessed and normalized according tothe amount of the PCR product of the Rpl27 gene0.00.20.40.6Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Контроль Малина, 0,063 % Малина, 0,031 %0.00.20.40.6Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Control Raspberry, 0.063% Raspberry, 0.031%0.00.20.40.60.81.0Контроль Малина, 0,063 % Малина, 0,031 %53Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Хrecommended for further studies of the effect it has oninduced COX-2, iNOS, and IL-8 expression, as well asfor in vivo studies of its anticarcinogenic activity.CONFLICT OF INTERESTThe authors declare that there is no conflict ofinterest related to this article.